Top » Catalog » FGC22260

$18.00

FGC22260
[FGC22260]

FGC22260
hg38 Position: ChrY:20958436..20958436
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22260_F ACTTCCAGTGACCCATCCAC
Reverse Primer: FGC22260_R AGAGGAATTCAGAACAAAGTACTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies