Top » Catalog » FGC31322

$18.00

FGC31322
[FGC31322]

FGC31322
hg38 Position: ChrY:7899229..7899229
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC1695 > BY8 > BY9 > BY136 > ZS2028
Forward Primer: FGC31322_F TTCTCCTGGAGGAAGCCAC
Reverse Primer: FGC31322_R GACAGAAAAATAATTGTTGAAACCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies