Top » Catalog » FGC5421

$18.00

FGC5421
[FGC5421]

FGC5421
hg38 Position: ChrY:10155971..10155971
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5422 > FGC5424 > FGC5418 > FGC5420
Forward Primer: FGC5421_F GCCAGCAGATGACATCAATG
Reverse Primer: FGC5421_R CAGAGGAGGCTGGTAAGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies