Top » Catalog » FGC5429

$18.00

FGC5429
[FGC5429]

FGC5429
hg38 Position: ChrY:16761676..16761676
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5422 > FGC5424 > FGC5418 > FGC5420
Forward Primer: FGC5429_F CCTTTGTTGGATGCCTAGTCTG
Reverse Primer: FGC5429_R AAGCTACACACCTACAACCAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies