Top » Catalog » FGC50954

$18.00

FGC50954
[FGC50954]

FGC50954
hg38 Position: ChrY:19482494..19482494
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC50954_F GAGGTTTAGTTTTAGATTGTCAGTGTG
Reverse Primer: FGC50954_R CAGAAGTCCCCAATGACAGTC
Reviews

Customers who bought this product also purchased
FGC50951
FGC50951
FGC50950
FGC50950
FGC50949
FGC50949
FGC50948
FGC50948
FGC50953
FGC50953
FGC50952
FGC50952
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies