Top » Catalog » A12490

$18.00

A12490
[A12490]

A12490
hg38 Position: ChrY:20960048..20960048
Ancestral: C
Derived: A
Reference: Alessandro Biondo (2016)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: A12490_F GTCAGAGAAGCATGCACAGC
Reverse Primer: A12490_R GAGGCAAGAAGGTTGAGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies