Top » Catalog » M223

$18.00

M223
[M223]

M223
hg38 Position: ChrY:19555421..19555421
Ancestral: G
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: I2a2a
Comments: A8.05e
Forward Primer: M223_F TGGCTCATGTTGCTTGAGTTC
Reverse Primer: M223_R ACTGATTCAGTAAATCTCCTAACTTTGC
Reviews

Customers who bought this product also purchased
DF105
DF105
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
CTS616
CTS616
M343
M343
DF49
DF49
A260
A260
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies