Top » Catalog » PF4189

$18.00

PF4189
[PF4189]

PF4189
hg38 Position: ChrY:16998664..16998664
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: I2a1a1a1a1a
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF4189_F ACACATGGGAATTCCTGGAC
Reverse Primer: PF4189_R TGAACGCGTCATCCAAATAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies