Top » Catalog » A656

$18.00

A656
[A656]

A656
hg38 Position: ChrY:19624008..19624008
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A656_F CCAGACAAATGAAAGCTGAGG
Reverse Primer: A656_R GCATAAACAATCATGCAAAAAGTAG
Reviews

Customers who bought this product also purchased
A5870
A5870
DF98
DF98
Z301
Z301
BY5719
BY5719
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
S268
S268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A965
1 x A315
1 x A170
1 x A2137
1 x A1277
1 x A799
1 x A181
1 x A1723
1 x A2268
1 x A655
1 x A94
1 x A298
1 x A1496
1 x A546
1 x A216
1 x A133
1 x A1133
1 x A1716
1 x A1502
1 x A438
1 x A899
1 x A353
1 x A1512
1 x A479
1 x A591
1 x A632
$468.00
Haplogroup Info
Other products
Currencies