Top » Catalog » A6

$18.00

A6
[A6]

A6
hg38 Position: ChrY:14498465..14498465
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a
Comments: Found in a R1b-L513 person
Forward Primer: A6_F GAGAGAGGTGCCAGAAATGG
Reverse Primer: A6_R ATTTCAGGGTGTTGGACAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2149
1 x A55
1 x A605
1 x A1494
1 x A1081
1 x A1159
1 x A461
1 x A742
1 x A996
1 x A750
1 x A542
1 x A208
1 x A1097
1 x A744
1 x A888
1 x A729
1 x A1002
$306.00
Haplogroup Info
Other products
Currencies