Top » Catalog » A725

$18.00

A725
[A725]

A725
hg38 Position: ChrY:7737991..7737991
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1b1
Comments: Below FGC4077
Forward Primer: A725_F AGCACTGTCAGCACACTTGC
Reverse Primer: A725_R TGTGAATCATGAGCAAATTTCAG
Reviews

Customers who bought this product also purchased
DF85
DF85
FGC42643
FGC42643
FGC42652
FGC42652
FGC42640
FGC42640
FGC42651
FGC42651
FGC42650
FGC42650
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies