Top » Catalog » M67

$18.00

M67
[M67]

M67
hg38 Position: ChrY:19716923..19716923
Ancestral: A
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2a1b
Comments: Aka S51/PF5137
Forward Primer: M67_F AGCAGAAAGAGGTGTGGGTC
Reverse Primer: M67_R TCCATTAAGTGTTCTCCTGATTTG
Reviews

Customers who bought this product also purchased
L911
L911
FGC43516
FGC43516
Z482
Z482
A14266
A14266
F15834
F15834
Y20492
Y20492
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies