Top » Catalog » M67

$18.00

M67
[M67]

M67
hg38 Position: ChrY:19716923..19716923
Ancestral: A
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2a1b
Comments: Aka S51/PF5137
Forward Primer: M67_F AGCAGAAAGAGGTGTGGGTC
Reverse Primer: M67_R TCCATTAAGTGTTCTCCTGATTTG
Reviews

Customers who bought this product also purchased
PH1038
PH1038
Y36618
Y36618
Z2222
Z2222
Z6270
Z6270
Y16996
Y16996
FGC45021
FGC45021
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies