Top » Catalog » A16521

$18.00

A16521
[A16521]

A16521
hg38 Position: ChrY:15661386..15661386
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A16521_F TGGTGGGAAATTCAAGGAAG
Reverse Primer: A16521_R TGCTAGCATTCACAAATCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies