Top » Catalog » Y22519

$18.00

Y22519
[Y22519]

Y22519
hg38 Position: ChrY:17163610..17163610
Ancestral: A
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: N1a1a1a1a2a1a1a1a1a1a (not listed)
Comments: Below Z5038 > Y21077
Forward Primer: Y22519_F TGTGTGTGCACATGCTACTCC
Reverse Primer: Y22519_R GCAATCCTCTTCCCCTAAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies