Top » Catalog » M1960

$18.00

M1960
[M1960]

M1960
hg38 Position: ChrY:15964123..15964123
Ancestral: T
Derived: C
Reference: Underhill et al.
ISOGG Haplogroup: R1a
Comments: unknown
Forward Primer: M1960_F GGCAGAAGGAAAAGGGAAAG
Reverse Primer: M1960_R TGCATTGCTGATAGCAGGTC
Reviews

Customers who bought this product also purchased
Y10819
Y10819
Y10818
Y10818
YP277
YP277
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies