Top » Catalog » FGC37835

$18.00

FGC37835
[FGC37835]

FGC37835
hg38 Position: ChrY:15276603..15276603
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC37835_F ACAGGAGATGAACCCTGTGC
Reverse Primer: FGC37835_R CCCATGAGGAGTTTCTCACC
Reviews

Customers who bought this product also purchased
FGC37840
FGC37840
FGC37834
FGC37834
FGC37836
FGC37836
FGC37830
FGC37830
FGC37825
FGC37825
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies