Top » Catalog » A18554

$18.00

A18554
[A18554]

A18554
hg38 Position: ChrY:15576003..15576003
Ancestral: T
Derived: G
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A18554_F GCTGTGATGTTTGCTGGTTG
Reverse Primer: A18554_R GCCCCCAGAACTGAGAGAG
Reviews

Customers who bought this product also purchased
ZS5804
ZS5804
YFS1350909
YFS1350909
FGC42837
FGC42837
FGC42835
FGC42835
A18552
A18552
A18555
A18555
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies