Top » Catalog » BY10023

$18.00

BY10023
[BY10023]

BY10023
hg38 Position: ChrY:8588217..8588217
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1a1b2a4c1a1a3~
Comments: Below BY6712
Forward Primer: BY10023_F CCACCCAAAGACCACTCAAC
Reverse Primer: BY10023_R CTCCATCTCCGTCAAGCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies