Top » Catalog » A19380

$18.00

A19380
[A19380]

A19380
hg38 Position: ChrY:12599766..12599766
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below L161.1 > A13665 > A19162
Forward Primer: A19380_F CTCCTGACCTCAGGTGATCC
Reverse Primer: A19380_R TTGCTGCTGCTCACTCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies