Top » Catalog » A955

$18.00

A955
[A955]

A955
hg38 Position: ChrY:9260595..9260595
Ancestral: C
Derived: T
Reference: Joe Fox (2014)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below L1/S26
Forward Primer: A955_F AAGAACTGATGGCACAGAACG
Reverse Primer: A955_R GCTGCCCAGTCATTAAAACAC
Reviews

Customers who bought this product also purchased
A699
A699
S4272
S4272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2142
1 x A1314
1 x A164
1 x A1308
1 x A985
1 x A759
1 x A350
1 x A1742
1 x A251
1 x A911
1 x A642
1 x A1539
1 x A1011
1 x A426
1 x A525
1 x A809
1 x A1072
1 x A1142
1 x A571
1 x A1079
1 x A1774
1 x A1274
1 x A726
1 x A932
$432.00
Haplogroup Info
Other products
Currencies