Top » Catalog » A90

$18.00

A90
[A90]

A90
hg38 Position: ChrY:20414685..20414685
Ancestral: C
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1b
Comments: Found in a R1b-CTS4466 person
Forward Primer: A90_F TCTCATACAATTAATTACAATACATACTCTGTATG
Reverse Primer: A90_R AGAGTGGATGGCTAGTGGCTG
Reviews

Customers who bought this product also purchased
A761
A761
A155
A155
A195
A195
A1333
A1333
CTS4466
CTS4466
ZS4590
ZS4590
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y13511
1 x Y12371
1 x Y16913
$54.00
Haplogroup Info
Other products
Currencies