Top » Catalog » A90

$18.00

A90
[A90]

A90
hg38 Position: ChrY:20414685..20414685
Ancestral: C
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1b
Comments: Found in a R1b-CTS4466 person
Forward Primer: A90_F TCTCATACAATTAATTACAATACATACTCTGTATG
Reverse Primer: A90_R AGAGTGGATGGCTAGTGGCTG
Reviews

Customers who bought this product also purchased
CTS4466
CTS4466
ZS4590
ZS4590
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
Z16259
Z16259
S1121
S1121
A541
A541
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies