Top » Catalog » A45

$18.00

A45
[A45]

A45
hg38 Position: ChrY:13844595..13844595
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5~
Comments: Found in a R1b-DF41 person
Forward Primer: A45_F AAATCATAGTTTAACTAAAGTACCCAAACC
Reverse Primer: A45_R CAAATATTACTAATTTATGCTCAGAAATGTTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS714
1 x Z31172
1 x DYS390
$37.90
Haplogroup Info
Other products
Currencies