Top » Catalog » S8104

$18.00

S8104
[S8104]

S8104
hg38 Position: ChrY:7564563..7564563
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a2a1b2a2a2b1
Comments: Below Y6882.
Forward Primer: S8104_F ATGGTCCTCCCTCTATGCAG
Reverse Primer: S8104_R TTGGTTTCATTTGGCACTTG
Reviews

Customers who bought this product also purchased
Y21996
Y21996
DNA Sample Kit
DNA Sample Kit
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies