Top » Catalog » SNPs » FGC29290

$19.00

FGC29290
[FGC29290]

FGC29290
hg38 Position: ChrY:19278814..19278814
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b1b
Comments: Downstream CTS4466 > A541 > S1121 > FGC29280
Forward Primer: FGC29290_F GCTGGCTACCATAAGTTATTACCG
Reverse Primer: FGC29290_R GAGGTTTGAGGCCGAGAGTC
Reviews

Customers who bought this product also purchased
FGC29286
FGC29286
FGC29285
FGC29285
FGC29293
FGC29293
FGC29278
FGC29278
FGC29292
FGC29292
FGC29289
FGC29289
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies