Top » Catalog » SNPs » YP254

$18.00

YP254
[YP254]

YP254
hg38 Position: ChrY:9554588..9554588
Ancestral: A
Derived: G
Reference: YFull (2014)
ISOGG Haplogroup: R1a1a1b1a1a1a
Comments: Downstream of YP258
Forward Primer: YP254_F ATCCTCCCACCTCAGCCTC
Reverse Primer: YP254_R TAAGTTATAAACATGTATCTTTTCATACGC
Reviews

Customers who bought this product also purchased
Z4624
Z4624
YP258
YP258
FT58750
FT58750
BY137355
BY137355
YP590
YP590
Y2912
Y2912
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies