Top » Catalog » SNPs » FGC14507

$18.00

FGC14507
[FGC14507]

FGC14507
hg38 Position: ChrY:16093684..16093684
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: FGC14507_F GAGATCACTTGAGCCCAAGAATAC
Reverse Primer: FGC14507_R TCTTGCAAGGATGCATCTTTAAC
Reviews

Customers who bought this product also purchased
FGC22113
FGC22113
FGC14508
FGC14508
FGC35958
FGC35958
FGC23547
FGC23547
A7628
A7628
S7660
S7660
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies