Top » Catalog » SNPs » A2302

$18.00

A2302
[A2302]

A2302
hg38 Position: ChrY:21294939..21294939
Ancestral: T
Derived: A
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below A725
Forward Primer: A2302_F GTCTTTGGCCCTTCAGCAG
Reverse Primer: A2302_R GCTGCCTGAGAATGGGGTAG
Reviews

Customers who bought this product also purchased
A2301
A2301
A2300
A2300
A2299
A2299
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A4676
1 x A2089
1 x A19263
$54.00
Haplogroup Info
Other products
Currencies