Top » Catalog » SNPs » Y128522

$15.00

Y128522
[Y128522]

Y128522
hg38 Position: ChrY:13495918..13495918
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y128522_F AATTCATATGCGATAGTCCACCC
Reverse Primer: Y128522_R TAAGTAATTCCTAGAACTGGGTTGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies