Top » Catalog » SNPs » S10250

$18.00

S10250
[S10250]

S10250
hg38 Position: ChrY:7547077..7547077
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2e2a
Comments: Approx. S9891
Forward Primer: S10250_F GAGAAGATATTTGGTGGACGTATACTAG
Reverse Primer: S10250_R CCTTGCTTTGTTTAGGTCAGATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30566
$18.00
Haplogroup Info
Other products
Currencies