Top » Catalog » SNPs » BY74

$18.00

BY74
[BY74]

BY74
hg38 Position: ChrY:6895193..6895193
Ancestral: A
Derived: G
Reference: FTDNA
ISOGG Haplogroup: J1a (not listed)
Comments: Below Z640
Forward Primer: BY74_F GAAAATCTAGATAGACACCAACAAAAGC
Reverse Primer: BY74_R GTAAGGAGTCCTTGATGTCTTGC
Reviews

Customers who bought this product also purchased
ZS1471
ZS1471
FGC1696
FGC1696
FT161154
FT161154
M267
M267
ZS1478
ZS1478
FT242666
FT242666
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies