Top » Catalog » SNPs » BY97555

$18.00

BY97555
[BY97555]

BY97555
hg38 Position: ChrY:12668555..12668555
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Below S17250 > PH908
Forward Primer: BY97555_F GGCCCAGAAAGTTGAGACAG
Reverse Primer: BY97555_R GTCCCAACTTTATGGGATGG
Reviews

Customers who bought this product also purchased
Y32084
Y32084
A13912
A13912
Y84307
Y84307
A356
A356
BY198275
BY198275
MF2888
MF2888
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies