Top » Catalog » SNPs » Y978

$19.00

Y978
[Y978]

Y978
hg38 Position: ChrY:15226325..15226325
Ancestral: C
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: J2b2 (not listed)
Comments: Found from public sources
Forward Primer: Y978_F CAGGTGCTGGAGGGGCTA
Reverse Primer: Y978_R CAGTTTTTATGGTTTCATAGTATTCCG
Reviews

Customers who bought this product also purchased
M241
M241
ZS290
ZS290
SK1408
SK1408
J2b-M12 Panel
J2b-M12 Panel
ZS280
ZS280
FT289310
FT289310
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies