Top » Catalog » SNPs » BY41853

$18.00

BY41853
[BY41853]

BY41853
hg38 Position: ChrY:14680085..14680085
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below Z338 > BY41853
Forward Primer: BY41853_F GATTCCCAGGGGTTCCAAG
Reverse Primer: BY41853_R CCAAGAGGAGAAAAAGTTTGAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies