Top » Catalog » SNPs » BY178014

$19.00

BY178014
[BY178014]

BY178014
hg38 Position: ChrY:7064904..7064904
Ancestral: G
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S971 > Z16267 > Z3000 > Z3004 > FGC41930
Forward Primer: BY178014_F AGTGCCTCTCTGGCTGGAG
Reverse Primer: BY178014_R CCCCATGATTCAATTATCTACACCT
Reviews

Customers who bought this product also purchased
A24206
A24206
A24208
A24208
R1b Tom Duffy Colla Panel
R1b Tom Duffy Colla Panel
Y22409
Y22409
A24200
A24200
A24192
A24192
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies