Top » Catalog » SNPs » S1194

$18.00

S1194
[S1194]

S1194
hg38 Position: ChrY:12556590..12556590
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L11. Parallel U106 P312. Upstream DF100 CTS4528
Forward Primer: S1194v2_F GAACTCTGAGGAGGGTGCAC
Reverse Primer: S1194v2_R GCATCTGCTGTAATTGTGTGGA
Reviews

Customers who bought this product also purchased
S15627
S15627
FGC12309
FGC12309
L145
L145
FT3093
FT3093
Z301
Z301
JFS0004
JFS0004
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies