Top » Catalog » SNPs » A4659

$18.00

A4659
[A4659]

A4659
hg38 Position: ChrY:14534970..14534970
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > DF17
Forward Primer: A4659_F ATGGCCCAAATATTAGCAGG
Reverse Primer: A4659_R TGCATTAAGTCTATCTGTTCCACATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A4676
$18.00
Haplogroup Info
Other products
Currencies