Top » Catalog » SNPs » CTS6867

$18.00

CTS6867
[CTS6867]

CTS6867
hg38 Position: ChrY:15045834..15045834
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: CTS6867_F TTAGGTGGTTATATGCTTTGGCTAC
Reverse Primer: CTS6867_R AAGAGGGAAACAAGATGAGATGTAG
Reviews

Customers who bought this product also purchased
BY31329
BY31329
Y146179
Y146179
BY194812
BY194812
CTS5636
CTS5636
BY31326
BY31326
PH137
PH137
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies