Top » Catalog » SNPs » BY31350

$18.00

BY31350
[BY31350]

BY31350
hg38 Position: ChrY:21468991..21468991
Ancestral: A
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: BY31350_F TGCTCTTGGAGAAGTGTAAGTAACTTAC
Reverse Primer: BY31350_R CCTGAATTAAGGCCTCTTGG
Reviews

Customers who bought this product also purchased
BY31326
BY31326
PH137
PH137
BY194812
BY194812
CTS11532
CTS11532
CTS5636
CTS5636
A25057
A25057
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies