Top » Catalog » SNPs » Y152276

$18.00

Y152276
[Y152276]

Y152276
hg38 Position: ChrY:8954647..8954647
Ancestral: T
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: Y152276_F CAGTGAGCTGAGATTGGGTG
Reverse Primer: Y152276_R GTAAGGTGCGCCTAAAATTCTAAC
Reviews

Customers who bought this product also purchased
CTS2658
CTS2658
CTS6867
CTS6867
BY31330
BY31330
Y146179
Y146179
CTS1221
CTS1221
CTS6449
CTS6449
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies