Top » Catalog » SNPs » FT118443

$18.00

FT118443
[FT118443]

FT118443
hg38 Position: ChrY:16662645..16662645
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT118443_F AGTGACAAGAACGATCAGAAAAAG
Reverse Primer: FT118443_R CAGAACTGCAAGATAAAACATTTGA
Reviews (1)

Customers who bought this product also purchased
FT117124
FT117124
FT119458
FT119458
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT118443
$18.00
Haplogroup Info
Other products
Currencies