Top » Catalog » SNPs » A25435

$18.00

A25435
[A25435]

A25435
hg38 Position: ChrY:13756264..13756264
Ancestral: T
Derived: C
Reference: Ole Selmer (2019)
ISOGG Haplogroup: I1
Comments: Below FGC9476
Forward Primer: A25435_F AACCATAGAATTTCTGTGCATGG
Reverse Primer: A25435_R CAGCACTCTGTTATGATCCAGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies