Top » Catalog » SNPs » A25462

$18.00

A25462
[A25462]

A25462
hg38 Position: ChrY:12171954..12171954
Ancestral: G
Derived: A
Reference: Alex Buchanan (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A25462_F TTATAAAGCAGGTCATTAGAGACTTAGG
Reverse Primer: A25462_R CAAAGTAATCATTGAGGGAAGACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies