Top » Catalog » SNPs » FGC30727

$18.00

FGC30727
[FGC30727]

FGC30727
hg38 Position: ChrY:7272293..7272293
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L371
Forward Primer: FGC30727_F TAGGGTCAGGGACTTATTTCTTTG
Reverse Primer: FGC30727_R TCACACCCAATTAAGCATATGTCT
Reviews

Customers who bought this product also purchased
FGC30731
FGC30731
FGC30630
FGC30630
FGC30730
FGC30730
FGC30737
FGC30737
R1b-L371 PUGH Panel
R1b-L371 PUGH Panel
FGC30729
FGC30729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies