Top » Catalog » SNPs » FGC30728

$18.00

FGC30728
[FGC30728]

FGC30728
hg38 Position: ChrY:9563086..9563086
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L371
Forward Primer: FGC30728_F CCGTAATTCATTGCCTTCTGC
Reverse Primer: FGC30728_R GTGCACTCTGGGAGGCC
Reviews

Customers who bought this product also purchased
FGC30729
FGC30729
FGC30734
FGC30734
FGC30727
FGC30727
FGC30733
FGC30733
FGC30632
FGC30632
FGC30732
FGC30732
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies