Top » Catalog » SNPs » FGC30737

$18.00

FGC30737
[FGC30737]

FGC30737
hg38 Position: ChrY:20837239..20837239
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L371
Forward Primer: FGC30737_F TAATTTCAACAGTGGGTTTAATATTTCAG
Reverse Primer: FGC30737_R CCGTACCATGATCATTACTTATTTTATTC
Reviews

Customers who bought this product also purchased
R1b-L371 PUGH Panel
R1b-L371 PUGH Panel
FGC30728
FGC30728
FGC30733
FGC30733
FGC30727
FGC30727
FGC30732
FGC30732
FGC30632
FGC30632
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies