Top » Catalog » SNPs » A5003

$18.00

A5003
[A5003]

A5003
hg38 Position: ChrY:8874648..8874648
Ancestral: A
Derived: G
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A5003_F ATTTCCTTGCTGAGCGTTTC
Reverse Primer: A5003_R TTTCACCTTGGGCAATTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19149
1 x A4596
$36.00
Haplogroup Info
Other products
Currencies