Top » Catalog » SNPs » Z17294

$18.00

Z17294
[Z17294]

Z17294
hg38 Position: ChrY:20394255..20394255
Ancestral: A
Derived: G
Reference: G. Magoon et al.
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a1a1
Comments: downstream of L513 > L193
Forward Primer: Z17294_F CAGCTCTGTGGAACATCATTTG
Reverse Primer: Z17294_R GCAATGTGTCTTCGCTGGTC
Reviews

Customers who bought this product also purchased
S5668
S5668
A8
A8
Z39589
Z39589
FGC32837
FGC32837
R1b-L513 Panel
R1b-L513 Panel
Z17815
Z17815
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies