Top » Catalog » SNPs » FGC22115

$18.00

FGC22115
[FGC22115]

FGC22115
hg38 Position: ChrY:8530671..8530671
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508 > FGC14512 > FGC17110 > YP1012
Forward Primer: FGC22115_F ACCAAAAAACAAACATCCCTG
Reverse Primer: FGC22115_R GGAACCCATCCAATTCTCACTAC
Reviews

Customers who bought this product also purchased
FGC14508
FGC14508
FGC35958
FGC35958
FGC23547
FGC23547
A7628
A7628
FGC14515
FGC14515
FGC35957
FGC35957
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies