Top » Catalog » SNPs » A5297

$18.00

A5297
[A5297]

A5297
hg38 Position: ChrY:21833419..21833419
Ancestral: C
Derived: T
Reference: Jason Scott (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1a2
Comments: Downstream S691
Forward Primer: A5297_F TTTATTGTTGTTGAGTCTCCAAACA
Reverse Primer: A5297_R TATCTTCACCCCTTTCTGAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2839
$18.00
Haplogroup Info
Other products
Currencies