Top » Catalog » SNPs » FGC32885

$18.00

FGC32885
[FGC32885]

FGC32885
hg38 Position: ChrY:21462422..21462422
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC32885_F CATATGTCTAAATAATAAGTGAATTGCTCG
Reverse Primer: FGC32885_R CTGACTCCTGTAAATTCAAATGTAGC
Reviews

Customers who bought this product also purchased
FGC23332
FGC23332
FGC33213
FGC33213
FGC23337
FGC23337
FGC19440
FGC19440
FGC31786
FGC31786
FGC23331
FGC23331
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies